Перейти к публикации

Рекомендованные сообщения

По полу они различаются размером головы. Развести, конечно, можно. Иначе - откуда они берутся? Кстати, начинаю продавать нового малька.

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах

Давайте фото малька, раз заинтриговали!!!!;)

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах
Оригинальное сообщение от dagus

По полу они различаются размером головы.

Хозяина?

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах
Оригинальное сообщение от Granata

Давайте фото малька, раз заинтриговали!!!!;)

Раз именно малька, то - на те. 8-10 мм.

a99ffc03d622a7d469767fce81da9305.jpg

aae9faa6521803c40b166c327dbfa04a.jpg

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах
Оригинальное сообщение от Мирон

Оригинальное сообщение от dagus

По полу они различаются размером головы.

Хозяина?

Размер головы хозяина не влияет на пол питомцев. Но её содержимое может (правда, часто лишь теоретически) помочь хозяину в оценке, выводах и даже - в получении результатов.

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах
Оригинальное сообщение от dagus

на те. 8-10 мм.

Забавно, довольно сильно от малька пчёлки отличается.

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах

Вот о том и речь - сильно отличаются!!!! Из истории в 1985 (ссылочки выше по теме) ясно что к Hector Luzardo попала пара которая дала около четверти (из всех мальков пчелки) нынешних блю демпси - о чем это говорит? О том что кто то был в эту пару все же подмешан....и выяснить кто уже не возможно!!!! И на селекционный отбор 200% не похоже!!!

Ну гибрид это, гибрид!!! И заметьте это не Азия!!!

А малечки вселяют крепкую надежду на бирюзовое будущее!!!!!! Прям танцевать хочется!!! Вы молодец!!! Делитесь опытом (условиям, кормами и т.д.)!!!!

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах

У нас они по 500 р продаются. размер около 7 см

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах
Оригинальное сообщение от Granata

Ну гибрид это, гибрид!!! И заметьте это не Азия!!!

А почему не мутация?

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах

Такие сильные изменения и в окрасе и в форме тела и в длине плавников за одну мутацию не могут получиться (если верить что пара была восьмиполосок)! Эволюционно или селекционно необходимо не одно поколение чтоб выросли такие вуалевые плавники, например! Природа не дура и если вдруг одному кобелю вдруг захотелось удленнить свои вторичные половые признаки, то это не значит что они у всего его потомства станут длинными, а тем более у всего вида! Тоже самое с окрасом!

Если просто выразится, то для генетических изменений, особенно тех что передаются по наследству нужны определенные условия, сильное или длительное воздействие определенных факторов, направленный отбор (естественный или искуственный)....

....и если предположить что это все же была мутация, то эти факторы должны были быть силой сравнимой с Чернобылем! Но после радиации красивее не становятся!:(

У всех живых организмов очень сильная защита от мутаций и сложная система естественного отбора.

Вот очень понятно и коротко про наше с вами заболевание, особенно важна вторая часть про скрещивание:

Часть 1 : http://aqua-shtiva.ucoz.ru/publ/12-1-0-18

Часть 2: http://aqua-shtiva.ucoz.ru/publ/12-1-0-19

Честно говоря, прочитав эту статью несколько раз у меня закрались сомнения что это вообще восьмиполоска!

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах

\"Такие сильные изменения и в окрасе и в форме тела и в длине плавников за одну мутацию не могут получиться (если верить что пара была восьмиполосок)! Эволюционно или селекционно необходимо не одно поколение чтоб выросли такие вуалевые плавники, например! Природа не дура и если вдруг одному кобелю вдруг захотелось удленнить свои вторичные половые признаки, то это не значит что они у всего его потомства станут длинными, а тем более у всего вида! Тоже самое с окрасом!

Если просто выразится, то для генетических изменений, особенно тех что передаются по наследству нужны определенные условия, сильное или длительное воздействие определенных факторов, направленный отбор (естественный или искуственный)....

....и если предположить что это все же была мутация, то эти факторы должны были быть силой сравнимой с Чернобылем! Но после радиации красивее не становятся!:(\"

Скажите пожалуйста кто вы по специальности, и в каком век закончили вуз?

К современной генетике и представлении об эволюции, ваше сообщение не имеет практически никакого отношения.

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах
Оригинальное сообщение от Granata

Такие сильные изменения и в окрасе и в форме тела и в длине плавников за одну мутацию не могут получиться (если верить что пара была восьмиполосок)! Эволюционно или селекционно необходимо не одно поколение чтоб выросли такие вуалевые плавники, например! Природа не дура и если вдруг одному кобелю вдруг захотелось удленнить свои вторичные половые признаки, то это не значит что они у всего его потомства станут длинными, а тем более у всего вида! Тоже самое с окрасом!

Если просто выразится, то для генетических изменений, особенно тех что передаются по наследству нужны определенные условия, сильное или длительное воздействие определенных факторов, направленный отбор (естественный или искуственный)....

....и если предположить что это все же была мутация, то эти факторы должны были быть силой сравнимой с Чернобылем! Но после радиации красивее не становятся!:(

У всех живых организмов очень сильная защита от мутаций и сложная система естественного отбора.

Вот очень понятно и коротко про наше с вами заболевание, особенно важна вторая часть про скрещивание:

Часть 1 : http://aqua-shtiva.ucoz.ru/publ/12-1-0-18

Часть 2: http://aqua-shtiva.ucoz.ru/publ/12-1-0-19

Честно говоря, прочитав эту статью несколько раз у меня закрались сомнения что это вообще восьмиполоска!

Похоже, что мы или о разной рыбе говорим, или на разных языках.

Как раз-таки при массовом (десятками и сотнями тысяч), аквариумном (не в природе) разведении рыбы, всевозможные мутации - дело вполне обычное и частое. Другое дело, что большинство из них не представляет никакого интереса.

Вспомните, хотя-бы, появление дискуса \"Голубиная Кровь\" и сколько новых пород, благодаря этому мутанту, есть на сегодняшний день. А времени-то прошло - с Гулькин нос.

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах

Я одного не понимаю - че вы люди такие злые то!;) Сразу какое образование??? В каком веке?

Я пишу диплом по теме \" Пути повышения квалификации менеджера\". Удовлетворила ваше любопытство? Ну давайте нападайте! Только сначала не поленитесь переведите на www.translate.ru статью что я размещу ниже!

Даже ДНК тесты не могут доказать кто это гибрид или морфа, и окончательный выяснить нет возможности. Так что мое мнение имеет место быть! Но что точно доказано что это рыбы в природе нет! Голубой РЕЦЕССИВНЫЙ ген только в мамках и заметьте о селективном отборе потомства пары БД речи быть не может т.к. ген рецессивный, что предполагает неполноценное потомство (что опять же говорит о признаках гибрида)! Две главные проблемы почему не смогли доказать гибрид или морфа:

1 - генетический банк не имеет всех образцов возможных родителей, да еще и нескольких поколений.

2 - большинство генома БД подвержено эффекту растворения от обратных скрещиваний.

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах

I can tell you that a paper has been submitted, to two seperate major publications. The original draft was over 8,000 words and over 50,000 characters. This lengthy report is too long for any publication I have been in touch with. Martin and I have tried several times to create concise versions of this paper to be published. The concise version is lacking in information simply because we had to lose 4,500 words. One of the publishers has still yet to reply with whether or not they are going to run with it. The other publication has since replied and has asked me to make some changes, which includes shortening it. I honestly feel that this subject is due 16,000 words, and anything less will leave a gap in the information. Martin Brammah has entertained the idea of throwing together a book with all of this info.

I have decided to go ahead and release the full version of this article here today, so that some of you can read over it and make this conversion everything it deserves to be. Before you read it, you should know that it has been a few months since it was written, and some things have changed since then that will shed more light on the subject. Also, you should know that peer review was done within it. We decided to not take an approach from one side of the spectrum...it just would not be fair to the general public to write a biased article. Instead, we used some examples from a moderator here by the name of Dave, who most clearly explained to us how these recent DNA results do not prove they are a color morph.

The results do indeed match with 100% clarity, the genes of a Jack Dempsey. The problem as he points out, is that the section of genes tested, was only roughly a 500bp sequence, with upwards of 20,000bps available. So while he says the test is a match for JDs, its only a match for that gene region. Other regions that have yet to be tested could indeed pan out to show something different. But the possibility of it showing through after 20+ years of back crossing to wild type JDs, is highly unlikely.

Now what this means, is that indeed any DNA test, whether it be mitachondrial or nuclear, will most likely always pan out to be a match of octofasciata, regardless of if we had a hybridization event or not. This is a thorn in the side of hybridization theorists, because this means no matter how much DNA testing is done, it will most likely always come out JD. This means even if we do take a close look at the entire genome, it most likely will show all JD DNA, no matter if it is a hybrid or color morph. Until science advances, and gives us a cheaper, faster and more accurate way to look into this, we will never know the real truth.

I say, that if the truth can\'t be had, then our opinions are all we got. It doesn\'t matter if you are a molecular biologist or not here, because all of our opinions are equal, and none of the evidence is conclusive...in fact most of it, is one big anomoly. You have many peices of evidence that could sway things in either direction.

Without prolonging this any longer, here is the article I have been holding back for months now. I want to first give credit for Martin Brammahs help, and for Daves input. I also want to thank those at the bluejax forum who banded together to help me foot the bill for the DNA testing. You guys at bluejax are really wonderful to work with. I should also note, this version was not the revised version. This is the more detailed version:

_______________________________________________________________________________

Just what we have all been waiting for, the results from the samples I have submitted for DNA comparison:

Cole, August 23, 2007

I have finished the experiment and I see no evidence for the EB being a hybrid.

I find exactly the same single sequence from each of the four samples you sent. This sequence exactly matches the JD sequence in Genbank. There is no hint in the EB samples of a second sequence that could have come from another species.

I will prepare you a written report with the sequence data.

Dave Price

FishDNA ID

Sample submissions:

EBF8 = electric blue female

EBM8 = electric blue male

JDF8 = jack dempsey female

JDM8 = jack dempsey male

SEQ EBF8-20-07-10-41 AM: 504 bp;

Composition 109 A; 109 C; 133 G; 153 T; 0 OTHER

Percentage: 21.6% A; 21.6% C; 26.4% G; 30.4% T; 0.0%OTHER

Molecular Weight (kDa): ssDNA: 155.89 dsDNA: 310.71

ORIGIN

1 TTTTACACTG GACTGGCTTT TCTGTTTTAA AATGTACTTT AATTGTGTTT AATGGCAAAA

61 TTTACACACA GTAAGGCATG TGAAGACTGT GATTCGTTAG ATTATGTGAG TTGCAGCACC

121 GGATGGCTCA TTTTTACGGC TAAGTAAGGC GTAGTAGAGC AGCTCCGGTC AATGAGTTTG

181 GGTTAGCGGG TAGCTAGCAG CAAGCAGCAG GCCGTGCATG TGTTCAGCTA GCCGCCACAG

241 AAGCGAGAAA AGGAGACCTT AAGTTCACTT TCAGGGCCGG AGGTTCAGAT TTTTTCATTG

301 TTGCTTATAT AGTTGTTTTG TAAGTTCCGC TATATGTCCA TGGTGCTGTT ATATCCATCT

361 GCTCAGCGCC TGTGAGCTAG CGCGGTGAGC TCTGGTGCTG CCCCTTTAGG TTAGCGCCGC

421 TCGCCCCGCA GCTCCTGGCT TTCAGTGAAG GATGGACGTT AAAGATGCTC CGCTGCCCTT

481 CAGCGGTTCT AACCCACATG TCTT

SEQ EBM8-20-07-9-44 AM: 503 bp;

Composition 109 A; 109 C; 133 G; 152 T; 0 OTHER

Percentage: 21.7% A; 21.7% C; 26.4% G; 30.2% T; 0.0%OTHER

Molecular Weight (kDa): ssDNA: 155.58 dsDNA: 310.09

ORIGIN

1 TTTTACACTG GACTGGCTTT TCTGTTTTAA AATGTACTTT AATTGTGTTT AATGGCAAAA

61 TTTACACACA GTAAGGCATG TGAAGACTGT GATTCGTTAG ATTATGTGAG TTGCAGCACC

121 GGATGGCTCA TTTTTACGGC TAAGTAAGGC GTAGTAGAGC AGCTCCGGTC AATGAGTTTG

181 GGTTAGCGGG TAGCTAGCAG CAAGCAGCAG GCCGTGCATG TGTTCAGCTA GCCGCCACAG

241 AAGCGAGAAA AGGAGACCTT AAGTTCACTT TCAGGGCCGG AGGTTCAGAT TTTTTCATTG

301 TTGCTTATAT AGTTGTTTTG TAAGTTCCGC TATATGTCCA TGGTGCTGTT ATATCCATCT

361 GCTCAGCGCC TGTGAGCTAG CGCGGTGAGC TCTGGTGCTG CCCCTTTAGG TTAGCGCCGC

421 TCGCCCCGCA GCTCCTGGCT TTCAGTGAAG GATGGACGTT AAAGATGCTC CGCTGCCCTT

481 CAGCGGTTCT AACCCACATG TCT

SEQ JDF8-20-07-8-47 AM: 500 bp;

Composition 109 A; 108 C; 133 G; 150 T; 0 OTHER

Percentage: 21.8% A; 21.6% C; 26.6% G; 30.0% T; 0.0%OTHER

Molecular Weight (kDa): ssDNA: 154.69 dsDNA: 308.24

ORIGIN

1 TTTTACACTG GACTGGCTTT TCTGTTTTAA AATGTACTTT AATTGTGTTT AATGGCAAAA

61 TTTACACACA GTAAGGCATG TGAAGACTGT GATTCGTTAG ATTATGTGAG TTGCAGCACC

121 GGATGGCTCA TTTTTACGGC TAAGTAAGGC GTAGTAGAGC AGCTCCGGTC AATGAGTTTG

181 GGTTAGCGGG TAGCTAGCAG CAAGCAGCAG GCCGTGCATG TGTTCAGCTA GCCGCCACAG

241 AAGCGAGAAA AGGAGACCTT AAGTTCACTT TCAGGGCCGG AGGTTCAGAT TTTTTCATTG

301 TTGCTTATAT AGTTGTTTTG TAAGTTCCGC TATATGTCCA TGGTGCTGTT ATATCCATCT

361 GCTCAGCGCC TGTGAGCTAG CGCGGTGAGC TCTGGTGCTG CCCCTTTAGG TTAGCGCCGC

421 TCGCCCCGCA GCTCCTGGCT TTCAGTGAAG GATGGACGTT AAAGATGCTC CGCTGCCCTT

481 CAGCGGTTCT AACCCACATG

SEQ JDM8-20-07-7-41 AM: 489 bp;

Composition 105 A; 104 C; 131 G; 148 T; 1 OTHER

Percentage: 21.5% A; 21.3% C; 26.8% G; 30.3% T; 0.2%OTHER

Molecular Weight (kDa): ssDNA: 151.32 dsDNA: 301.46

ORIGIN

1 TTTTACACTG GACTGGCTTT TCTGTTTTAA AATGTACTTT AATTGTGTTT AATGGCAAAA

61 TTTACACACA GTAAGGCATG TGAAGACTGT GATTCGTTAG ATTATGTGAS TTGCAGCACC

121 GGATGGCTCA TTTTTACGGC TAAGTAAGGC GTAGTAGAGC AGCTCCGGTC AATGAGTTTG

181 GGTTAGCGGG TAGCTAGCAG CAAGCAGCAG GCCGTGCATG TGTTCAGCTA GCCGCCACAG

241 AAGCGAGAAA AGGAGACCTT AAGTTCACTT TCAGGGCCGG AGGTTCAGAT TTTTTCATTG

301 TTGCTTATAT AGTTGTTTTG TAAGTTCCGC TATATGTCCA TGGTGCTGTT ATATCCATCT

361 GCTCAGCGCC TGTGAGCTAG CGCGGTGAGC TCTGGTGCTG CCCCTTTAGG TTAGCGCCGC

421 TCGCCCCGCA GCTCCTGGCT TTCAGTGAAG GATGGACGTT AAAGATGCTC CGCTGCCCTT

481 CAGCGGTTC

Alignment of the four sequences with the two JD sequences from Genbank (bottom two rows):

JDM-8-20-07 TTTTACACTGGACTGGCTTTTCTGTTTTAAAATGTACTTTAATTGTGTTTAATGGCAAAA

JDF8-20-07 TTTTACACTGGACTGGCTTTTCTGTTTTAAAATGTACTTTAATTGTGTTTAATGGCAAAA

EBM8-20-07 TTTTACACTGGACTGGCTTTTCTGTTTTAAAATGTACTTTAATTGTGTTTAATGGCAAAA

EBF8-20-07 TTTTACACTGGACTGGCTTTTCTGTTTTAAAATGTACTTTAATTGTGTTTAATGGCAAAA

DQ119255 TTTTACACTGGACTGGCTTTTCTGTTTTAAAATGTACTTTAATTGTGTTTAATGGCAAAA

DQ836808 ----------------CTTTTCTGTTTTAAAATGTACTTTAATTGTGTTTAATGGCAAAA

********************************************

JDM-8-20-07 TTTACACACAGTAAGGCATGTGAAGACTGTGATTCGTTAGATTATGTGASTTGCAGCACC

JDF8-20-07 TTTACACACAGTAAGGCATGTGAAGACTGTGATTCGTTAGATTATGTGAGTTGCAGCACC

EBM8-20-07 TTTACACACAGTAAGGCATGTGAAGACTGTGATTCGTTAGATTATGTGAGTTGCAGCACC

EBF8-20-07 TTTACACACAGTAAGGCATGTGAAGACTGTGATTCGTTAGATTATGTGAGTTGCAGCACC

DQ119255 TTTACACACAGTAAGGCATGTGAAGACTGTGATTCGTTAGATTATGTGAGTTGCAGCACC

DQ836808 TTTACACACAGTAAGGCATGTGAAGACTGTGATTCGTTAGATTATGTGACTTGCAGCACC

************************************************* **********

JDM-8-20-07 GGATGGCTCATTTTTACGGCTAAGTAAGGCGTAGTAGAGCAGCTCCGGTCAATGAGTTTG

JDF8-20-07 GGATGGCTCATTTTTACGGCTAAGTAAGGCGTAGTAGAGCAGCTCCGGTCAATGAGTTTG

EBM8-20-07 GGATGGCTCATTTTTACGGCTAAGTAAGGCGTAGTAGAGCAGCTCCGGTCAATGAGTTTG

EBF8-20-07 GGATGGCTCATTTTTACGGCTAAGTAAGGCGTAGTAGAGCAGCTCCGGTCAATGAGTTTG

DQ119255 GGATGGCTCATTTTTACGGCTAAGTAAGGCGTAGTAGAGCAGCTCCGGTCAATGAGTTTG

DQ836808 GGATGGCTCATTTTTACGGCTAAGTAAGGCGTAGTAGAGCAGCTCCGGTCAATGAGTTTG

************************************************************

JDM-8-20-07 GGTTAGCGGGTAGCTAGCAGCAAGCAGCAGGCCGTGCATGTGTTCAGCTAGCCGCCACAG

JDF8-20-07 GGTTAGCGGGTAGCTAGCAGCAAGCAGCAGGCCGTGCATGTGTTCAGCTAGCCGCCACAG

EBM8-20-07 GGTTAGCGGGTAGCTAGCAGCAAGCAGCAGGCCGTGCATGTGTTCAGCTAGCCGCCACAG

EBF8-20-07 GGTTAGCGGGTAGCTAGCAGCAAGCAGCAGGCCGTGCATGTGTTCAGCTAGCCGCCACAG

DQ119255 GGTTAGCGGGTAGCTAGCAGCAAGCAGCAGGCCGTGCATGTGTTCAGCTAGCCGCCACAG

DQ836808 GGTTAGCGGGTAGCTAGCAGCAAGCAGCAGGCCGTGCATGTGTTCAGCTAGCCGCCACAG

************************************************************

JDM-8-20-07 AAGCGAGAAAAGGAGACCTTAAGTTCACTTTCAGGGCCGGAGGTTCAGATTTTTTCATTG

JDF8-20-07 AAGCGAGAAAAGGAGACCTTAAGTTCACTTTCAGGGCCGGAGGTTCAGATTTTTTCATTG

EBM8-20-07 AAGCGAGAAAAGGAGACCTTAAGTTCACTTTCAGGGCCGGAGGTTCAGATTTTTTCATTG

EBF8-20-07 AAGCGAGAAAAGGAGACCTTAAGTTCACTTTCAGGGCCGGAGGTTCAGATTTTTTCATTG

DQ119255 AAGCGAGAAAAGGAGACCTTAAGTTCACTTTCAGGGCCGGAGGTTCAGATTTTTTCATTG

DQ836808 AAGCGAGAAAAGGAGACCTTAAGTTCACTTTCAGGGCCGGAGGTTCAGATTTTTTCATTG

************************************************************

JDM-8-20-07 TTGCTTATATAGTTGTTTTGTAAGTTCCGCTATATGTCCATGGTGCTGTTATATCCATCT

JDF8-20-07 TTGCTTATATAGTTGTTTTGTAAGTTCCGCTATATGTCCATGGTGCTGTTATATCCATCT

EBM8-20-07 TTGCTTATATAGTTGTTTTGTAAGTTCCGCTATATGTCCATGGTGCTGTTATATCCATCT

EBF8-20-07 TTGCTTATATAGTTGTTTTGTAAGTTCCGCTATATGTCCATGGTGCTGTTATATCCATCT

DQ119255 TTGCTTATATAGTTGTTTTGTAAGTTCCGCTATATGTCCATGGTGCTGTTATATCCATCT

DQ836808 TTGCTTATATAGTTGTTTTGTAAGTTCCGCTATATGTCCATGGTGCTGTTATATCCATCT

************************************************************

JDM-8-20-07 GCTCAGCGCCTGTGAGCTAGCGCGGTGAGCTCTGGTGCTGCCCCTTTAGGTTAGCGCCGC

JDF8-20-07 GCTCAGCGCCTGTGAGCTAGCGCGGTGAGCTCTGGTGCTGCCCCTTTAGGTTAGCGCCGC

EBM8-20-07 GCTCAGCGCCTGTGAGCTAGCGCGGTGAGCTCTGGTGCTGCCCCTTTAGGTTAGCGCCGC

EBF8-20-07 GCTCAGCGCCTGTGAGCTAGCGCGGTGAGCTCTGGTGCTGCCCCTTTAGGTTAGCGCCGC

DQ119255 GCTCAGCGCCTGTGAGCTAGCGCGGTGAGCTCTGGTGCTGCCCCTTTAGGTTAGCGCCGC

DQ836808 GCTCAGCGCCTGTGAGCTAGCGCGGTGAGCTCTGGTGCTGCCCCTTTAGGTTAGCGCCGC

************************************************************

JDM-8-20-07 TCGCCCCGCAGCTCCTGGCTTTCAGTGAAGGATGGACGTTAAAGATGCTCCGCTGCCCTT

JDF8-20-07 TCGCCCCGCAGCTCCTGGCTTTCAGTGAAGGATGGACGTTAAAGATGCTCCGCTGCCCTT

EBM8-20-07 TCGCCCCGCAGCTCCTGGCTTTCAGTGAAGGATGGACGTTAAAGATGCTCCGCTGCCCTT

EBF8-20-07 TCGCCCCGCAGCTCCTGGCTTTCAGTGAAGGATGGACGTTAAAGATGCTCCGCTGCCCTT

DQ119255 TCGCCCCGCAGCTCCTGGCTTTCAGTGAAGGATGGACGTTAAAGATGCTCCGCTGCCCTT

DQ836808 TCGCCCCGCAGCTCCTGGCTTTCAGTGAAGGATGGACGTTAAAGATGGTCCGCTGCCCTT

*********************************************** ************

JDM-8-20-07 CAGCGGTTC---------------------------------------------------

JDF8-20-07 CAGCGGTTCTAACCCACATG----------------------------------------

EBM8-20-07 CAGCGGTTCTAACCCACATGTCT-------------------------------------

EBF8-20-07 CAGCGGTTCTAACCCACATGTCTT------------------------------------

DQ119255 CAGCGGTTCTAACCCACATGTCTTTATTTCGCCGTGCAGAGACAAAGGCCATGTTCAGTA

DQ836808 CGGCGGTTCTAACCCACATGTCTTTA----------------------------------

* *******

JDM-8-20-07 ---

JDF8-20-07 ---

EBM8-20-07 ---

EBF8-20-07 ---

DQ119255 CCA

DQ836808 ---

You might think a PhD in molecular biology would be necessary to understand the information provided in this article, but I have managed, and I am nothing more then your average night auditor at a luxury seaside hotel! It is true however that I have an above average interest in the truth behind whether this beautiful fish is a hybrid or color-morph. I want to get to the bottom of how the Electric Blue Jack Dempsey (EBJD) came to be, and I am willing to go to the extremes to get as much factual information on the subject as possible.

This new round of DNA testing many had hoped would be the nail in the coffin ending the long standing debate over whether or not the EBJD is of hybrid origin, but this information has only given rise to many more questions that are certainly in need of answers. Why exactly does this test not prove 100% conclusively that EBJD is a color-morph? What can be done to find a solid answer on the question that has seemed to leave so many perplexed for so long? While we can answer those two questions, unfortunately the one major question still remains: Is an EBJD a color-morph or a hybrid?

The first time I saw an EBJD was in the early part of 2006 in some pictures on the Cichlid-forum. I believe the famous thread was titled ‘Ormed’s breeding experience’. The journal he kept contained pictures of his beautiful EBJD pairing up with a standard Jack Dempsey (Rocio octofasciata). I continued to look through the article and was reading about the complicated breeding procedures used to produce these fish when I stumbled across some photos of Ormed’s tanks filled with juvenile Electric Blues. This was the most outstanding blue color and pattern combination I surely had ever seen. I had been keeping Jack Dempsey’s for many years, and had never seen anything like this before. I remember coming home from a hard nights work, looking at my fish tanks and thinking to myself, “I’ve got to acquire one of those EBJDs.”

Several months went by and I finally spotted a couple available at my local fish store selling for $30 a piece. Unfortunately my pocket was too light for that sort of expenditure. It took me a couple days to get the money lined up, and by that time only one of them was left. I made the quick purchase, brought him home and have been hooked ever since on this marvelous creature. I did research on everything about these fish to make sure I could keep mine alive. I read many horror stories about people spending hundreds of dollars on these fish, just to get them home and have them die within the first couple days or weeks. I was intrigued with all the mysteries I kept finding about these fish. Lots of people were speculating about genetic weaknesses and about intestinal disorders possibly caused by Hexamita. As such, many people were debating about the origins of this fish. I came across an article that was famous in the cichlid community, detailing how this fish was first discovered. For those who are not familiar with Hector Luzardo, or have not read the story in a while, here it is as a refresher:

I remember my first acquaintance with the hottest novelty in the South American fish trade: the blue Jack Dempsey. It was at a small fish exhibition in Uruguay, and a young pair was shown in a 25-gallon tank.

My first impression was that they were misplaced among other freshwater tanks, since they seemed to be reef fish, so strong was their bright turquoise color. That was back in 1986, and since then this fish has occasionally been available, but always in limited numbers. No one seemed to know who was breeding them (although it was said that they came from Argentina), and the few people who tried to get a successful spawn from them (including myself) faced complete failure.

Even when the eggs hatched, the feeble fry were never able to swim, dying after a couple of days. The blue Jack Dempsey slowly acquired a legendary status, and speculations started to flow. Was it a new species, a mutation, or a sterile hybrid from two different species? The situation was much like what happens today with the blood red parrot. I had to wait more than a decade to meet Mr. Hector Luzardo, the man we could call the creator of this colorful morph, to find out the real story behind this unusual fish.

It all started in 1985 when Mr. Luzardo received a mated pair of young Cichlasoma octofasciatum as a gift from a friend. They had already spawned in the community aquarium where they lived, but the eggs disappeared in a few hours. It was a nice pair of young adult fish, but they were nothing to write home about. As soon as they were installed in their own tank, they produced a huge spawn of about 2,000 eggs, and the fry were removed to another tank after the eggs hatched. When the fry were about 20 days old, Mr. Luzardo removed a couple of young fish that were floating in the tank, their fins ripped and many scales torn.

Their color seemed to be paler than usual, but he thought it was due to the missing scales. The next day there were about four fish in the same condition, and still more the day after. Soon it was clear that this was more than just the weaker fry being attacked by the tougher ones. There were some fish in the tank that looked and behaved very strangely.

A closer look revealed about one-fourth of the fry gathering in one corner, looking smaller and thinner than the rest of their siblings. They were immediately transferred to another tank. After a couple of weeks the pale creamy color of the young fish slowly turned into a bright turquoise blue, growing into something completely different from their parents. A whole new type of fish had arisen.

Having bred them for over ten years, it is now clear that color is only one of the differences. The blue Dempsey\'s usually have a more elongated body, show more individual variations in the dot pattern, and lack the large lateral spot. They aren\'t always hungry, as are the standard kind, and they grow slower, although they reach the same adult size in the end. They are also mild-tempered, but only if you compare them to regular Jack Dempsey\'s. In fact, these fish are sometimes called the Pacific Dempsey by the local traders as a reference to their peaceful natures. In the local trade they have also been called blue Jack Dempsey\'s, although turquoise would be a more accurate word to describe their color. Baby blue Dempsey\'s are so lightly colored that it\'s hard to notice when they have white spot, a disease they are prone to catch during their first four weeks. They are easily cured if kept at 90°F (32°C) for three to five days. After their first month they become as strong and healthy as any other member of the genus, thriving in neutral, slightly hard water around 75°F (24°C).

In spite of the obvious differences from the rest of their siblings, young blue Dempsey\'s are not treated differently by their parents, who seem to recognize those pale fish as their own fry, treating them just like they do their ordinary fry. The reason nobody was able to breed the fish is that a pair of two blue Dempsey\'s will always produce sterile spawns or very weak wrigglers that will die within a couple of days. To succeed, Luzardo mates a blue fish with a common one that carries the \"blue\" genes. This way about 50 percent of the offspring are blue. If you have two common fish that carry the blue genes, only 25 percent of their descendants will turn blue. Care must be taken when pairing mixed couples, as the blue individuals can suffer from the rowdy behavior of members of the normal type. As strange as it may sound, this beautiful fish is barely known outside South America. They are only being bred by Mr. Luzardo, who has about 20 mated pairs, so it has always been available only in small numbers. A serious attempt to distribute this variety in North America and Europe has yet to be done.

Recently a shipment was sent to Germany to test the interest among the German hobbyists. I believe it is only a matter of time after introducing this outstanding animal to the cichlid fans before they become an excellent addition to their tanks. Soon they will become a sought-after item for all cichlidophiles worldwide

Of all the speculations that were out there regarding these fish, none were more interesting to me than the debate over whether this fish had hybrid or natural origins. I started to find there was a huge community of people claiming that EBJDs are hybrids, offspring of two totally separate species. Even on threads where some were simply asking about health issues, people were popping in making them aware that they should not even own this fish because it is a hybrid. Others claimed that a DNA test had been carried out proving that EBJDs were none other than Rocio octofasciata. It had also been suggested that the breeding procedure used and the percentage of the EBJDs per spawn were evidence that EBJDs are a color-morph of the Jack Dempsey. However, some people insisted that the same could be true if they were a hybrid. I came to find that no matter what points were made, the situation was by no means settled. There appear to be many anomalies that exist within both possibilities.

Personally I was never one to sit around and debate a subject if tangible evidence could be had to get a factual answer to the question. From what I had read, factual evidence existed in the form of DNA sequencing that had been commissioned by Jeff Rapps of Tangled Up In Cichlids. Attaining this evidence to view with my very own eyes became a difficult proposition.

A couple months slipped by, and in that time I managed to acquire several more specimens of Electric Blue Jack Dempsey. I was so caught up in these fish that I decided to get rid of my managuense and my entire stock of standard Jack Dempseys, so that I could make room for all the new arrivals. I searched high and low for answers to the many questions I still had about these fish, and could not for the life of me figure out why there was such a lack of information. I had made a suggestion on www.cichlid-forum.com that perhaps it would be nice for a person with some computer knowledge to make a website completely devoted to these fish. I thought it would be helpful to have all the information in one place, so that the people experiencing health issues with their fish could get better answers. I also thought it would be great to have a site where everyone could debate the best ways of keeping these fish, and in turn learn more about the mysteries of the EBJD. In a matter of days someone was requesting new members for the EBJD Forum (http://bluejax.14.forumer.com). This was exactly what the EBJD community needed to spark the interest of people who could help us to find the answers we had all been looking for. I was hoping this community of EBJD keepers would thrive and grow into a successful forum, and it since has. Within the first year the site gained more than 100 members from all parts of the globe. Information began to pour in. Famous breeders of the species began to join the site and teach us the best methods for raising and breeding these beautiful fishes. It was a dream come true, to say the least.

It was soon after that a thread on the EBJD Forum became available in the ‘Hybrid or Color Morph?’ folder containing the results of the first ever DNA test known to have been completed on an EBJD. This was apparently the test Jeff Rapps had commissioned. Just in case some of you are interested and have not seen it, I am providing a copy of the results of that DNA test here:

External Image

External Image

External Image

External Image

The owner of the EBJD Forum, Martin Brammah, apparently requested this copy of the results directly from Jeff Rapps, and posted it so all of the forum members could see. Martin was quick to point out to that this test was carried out using mitochondrial DNA. As mitochondrial DNA is maternally inherited, these results only support the hypothesis that the EBJD is related to the maternal lineage of Rocio octofasciata. They tell us nothing about the paternal lineage. As a result, these findings don’t really support the hypothesis that EBJDs are a color morph of the Jack Dempsey. At this stage it was still possible for the EBJD to be a hybrid.

To me, it seemed as though something more could be done to get to the bottom of all this. I thought there had to be a way to show that EBJDs have the same DNA as the paternal lineage of Rocio octofasciata; at the very least it could somehow be proved that EBJD DNA did not contain DNA from another species. Or perhaps it did contain foreign DNA, and finding it would simply entail matching the foreign DNA with that of Nandopsis tetracanthus, or another potential parental species. At any rate I felt answers could be had, and it was just a matter of getting in touch with the right people. This is where my quest for answers began.

To start my journey toward the truth, I began with calling my local state biologist for the Department of Natural Resources. The person on the other end of the phone was overwhelmed by all of the information I put before her. She was thoroughly intrigued, and completely at a loss of what to do at the same time. Most importantly she wanted to help. It took her a few days but eventually she forwarded me a link to the National Department of Fish & Wildlife forensics lab. With a department title like that I thought for sure they would be of tremendous help. Well to my dismay I hit a temporary dead end upon hearing back from them. Apparently they would only accept criminal forensics cases from government agents concerning fish and wildlife. I tried to attain more useful information from my state biologist, but it seemed she had nothing more to offer me. Once again I was on my own.

I began researching Universities that were likely to have students or professors who would be able to lend us a hand. I also had a look at different laboratories that perform DNA tests. Most of the sites I came up with were for companies doing DNA tests related to paternity and genealogy. Finding the proper people to perform the tests I needed to have done seemed to be taking more time than would be required to actually complete them. Eventually, however, I came upon a site that would surely pan out. A site named FishDNA ID (www.fishdnaid.com) seemed to be a perfect candidate for the task at hand. I emailed directly the gentleman who owns the lab, Dr. David Price, and began explaining exactly what I was after. Dr. Price was incredibly helpful, answering all of my questions (and there were a lot) and bringing us closer to our goal of getting the DNA test performed. He explained that the nuclear DNA analysis we required was not the sort typically carried out by FishDNA ID, but that he could recommend some other places to look. He also suggested that we check out a site called Genbank. The Genbank sequence database is an open access, annotated collection of all publicly available nucleotide sequences and their protein translations. It is here that he advised we look for people who had submitted nucleotide sequences from standard Jack Dempseys. Dr. Price felt that if we looked for others who had studied common Jack Dempsey DNA, perhaps they would be willing to lend a hand in helping us map some EBJD DNA.

Dr. Price even linked me to many submissions in Genbank that contained octofasciata DNA records. We found an abundance of posts with DNA that was investigated and submitted by Dr. Prosanta Chakrabarty. Not only did we find the JD DNA we were looking for, but we also found a long list of other cichlid DNA on file, one of which was Nandopsis tetracanthus (suspected to be one of the parent species by some of those who believe the EBJD to be a hybrid). It was obvious that Dr. Chakrabarty would be the best person to contact regarding our dilemma. I emailed Dr. Chakrabarty the copy of the DNA results Jeff Rapps had commissioned, and asked if similar work could be done to prove more than just the mitochondrial line. I explained that I found his name listed with similar work done for JD’s in Genbank. I was not prepared for the reply I received from him:

Dear Cole,

The letter you scanned was a letter I sent to Jeff Rapps after he asked me what the electric blue might be. Inferring from the molecular evidence I obtained (both mitochondrial and nuclear), the electric blue is a Jack Dempsey. I don\'t know where the rumor started about it being a hybrid with tetracanthus but I can assure you that it is not. The blue dempsey does not appear to occur in the wild, I would speculate that the color morph appears because of inbreeding within the aquarium trade.

Hope that helps,

- Prosanta

Prosanta Chakrabarty, Ph.D.

Postdoctoral Fellow

Department of Ichthyology

American Museum of Natural History

Central Park West at 79th St.

New York, NY 10024

I was shocked to learn that I had emailed the gentleman that completed the first EBJD DNA test. I felt as if I had hit the jackpot, and surely would not need to look any further. Within his email reply he claims that a nuclear DNA test was completed as part of his analysis. In order to try and settle the debate, we requested to have a look at this information. We wondered why only the mitochondrial evidence was furnished, leaving out the nuclear DNA. In a matter of days Martin and I had both received similar replies:

Tell you what, since this seems to be an important subject to cichlidophiles, I\'ll publish something in Buntbarshe. I\'ll start over though. I have the blues from Jeff and wild caught octofasciatus in Ann Arbor where I am going next month. It won\'t take long so I should have something that will convince you guys soon.

- Prosanta

This is exactly what we had been searching for! Finally someone was willing to go the extra mile to help us get answers. However, Prosanta turned out to not be the only one willing to help. About a week went by and out of the blue I received more email replies from Dr. David Price of FishDNA ID.

Cole,

If you cannot get an answer otherwise, I could do some nuclear gene sequencing to try to answer this question. I see that there is some background data on suitable genes for some of the relevant species. But this project would not be simple; it would require sequencing the relevant gene from a good number of individuals.

I see that there is data in Genbank on the sequence of an intron in the S7 ribosomal protein gene for all the species of interest. If we want to do some exploratory research, I would suggest that we sequence this region from the EBJD or the Blue gene carrying JD (or both). I usually ask for 1 milligram of tissue for DNA analysis, but can work with less - a fin clip should be suitable. Generally, it is easiest to put the tissue in an excess (at least 10-fold) of alcohol to preserve it for shipment. For the first experiment I would sequence the PCR product directly. If the PCR is actually a mixture of two forms in more or less equal amounts (as for a standard heterozygote) this should show up with direct sequencing. If this gives just the JD sequence, then we will need to re-think, but this result would weaken the case for a hybrid.

I could do this experiment for $150.

Dave Price

It surely sounded like a costly experiment, but one that was definitely in need of doing. I figured if anything, this would be a great place to start. To my surprise members of the EBJD Forum banded together and began offering me donations to expedite this project. I was overwhelmed by the support, and soon enough $122 was brought in to help pay for the testing. The only thing left to do was to take fin clip samples from the fish and mail them off.

I purchased a new pair of scissors, bottle of rubbing alcohol, contact lens cases and a padded envelope. I kept a bucket of Aquari-sol spiked water on hand to dip my large net in, just prior to going in after each fish. I used a ruler taped to a clean cutting board to get accurate measurements of my fish during the procedure. I cleaned everything off with rubbing alcohol, and let it dry just prior to the fin sampling.

I began with the regular JDs first to get a handle on things. I took ~1cm2 fin samples from each fish and submerged the samples in the lens cases filled with alcohol. The first lens case contained a male JD and a female JD fin clip. I repeated the same process with the EBJDs. In all I got 4 snips, 1 from a male JD, 1 female JD, 1 male EBJD and 1 female EBJD.

Just prior to fin sampling I heavily fed all my fish, and then performed a 25% water change to make sure it was as clean as possible in the tanks. Directly after sampling, I did a second water change of about 33%. This time I dosed with Melafix and salt to make sure there was a proper route to recovery for them.

This procedure, no matter how careful you try to be, is completely intrusive on these fish. Fortunately, I was smart enough to practice on the JDs first. I just want to say that pulling a fish out of its home, handling it with bare hands, and systematically snipping its fin is going to be a once in a lifetime occurrence for these fish. I am glad all of this served a scientific purpose.

Twelve days slipped by and I finally received the email we had all been waiting for! Surely these findings are going to be enough to say one way or another these fish are hybrid or color-morph. Or are they?

Martin picks up the story from here……

Cole has done a great job of introducing this topic and I would like to say at this point that without his hard work, the test that prompted the writing of this article would never have been carried out. I would also like to extend my thanks to the members of the EBJD Forum who have helped Cole, both in terms of their financial contributions and in their support of his endeavor. It’s a great thing when people work together to achieve a common goal.

In my section of the article, I begin by considering the truth behind a number of rumors concerning the EBJD. I then look at what evidence there is to support the hypothesis that the EBJD is the result of a naturally occurring mutation; consider future experiments that might provide yet more insight into this debate; and attempt to answer the somewhat controversial question: does it really matter whether or not EBJDs are hybrid fish?

Look on any online cichlid-related forum and do a search for EBJD. Chances are you will be overwhelmed with information. The question is: how much of this information is supported by evidence and how much of it is hearsay? This question is what led me to create the website www.bluejax.co.uk and the associated EBJD Forum. I wanted to put all the information in one place and then work with other EBJD owners to determine fact from fiction. The first thing that confused me was the number of posts I read claiming that female EBJDs were rare. Of the two juveniles that I owned, I was fairly sure that one was female. When the two fish spawned I was left in no doubt. It seemed odd to me that people would assume females were rare, given that I had managed to find one in the UK and the American supplies of EBJD were so much larger. Once the EBJD Forum was set up and the membership started to grow, a number of other people confirmed that they had female EBJDs too. There are now at least five members (off the top of my head) who have female EBJDs. Bear in mind that: a) many members only have one EBJD, so are unlikely to be able to sex their fish; and B) the majority of members own fish too young to breed. As such, I do not believe that female EBJDs are rare. In my opinion this theory was started because in breeding blue-gene carrying Jack Dempseys (hereafter referred to as BGJDs) the most common practice is to breed a male EBJD to a normal Jack Dempsey (hereafter referred to as JDs). Because of this, the majority of people owning such a pair would have no use for a female EBJD and therefore would pick the most male-looking fish. In addition, some female EBJDs (including my own) are less spectacularly colored than males, and therefore someone looking for a single fish would be less likely to choose that fish from the dealer’s tank. Finally, I have noticed that most people treat single specimens of hard-to-sex cichlid species as males (don’t ask me why!). All three scenarios would lead to the majority of people having experience of EBJDs that they at least took to be male (these fish are notoriously hard to sex without examining the breeding tube of adults during spawning).

The process of breeding BGJDs introduces another topic that I would like to discuss. It has been suggested that in order to produce BGJDs, the male parent must always be an EBJD and the female a JD. From my initial research it appeared that this was because JDs are much more aggressive (and also cheaper) than EBJDs, hence a male EBJD is unlikely to kill an unsuitable female JD (and if it does female JDs are cheap to replace), but a male JD is quite likely to kill an unsuitable female EBJD (which would be very expensive to replace). From a genetics point of view, there is no reason why the cross wouldn’t work both ways. For the sake of clarity:

Male/ female EBJD = bb (homozygous recessive)

Male/ female JD = BB (homozygous dominant)

Punnet square:

B B

______________

b Bb Bb

b Bb Bb

100% of offspring have the Bb genotype i.e. they are all BGJDs (i.e. they look like JDs, but carry the recessive gene for blue coloration ‘b’)

Others have claimed that the cross must be carried out in this way because female EBJDs are infertile and so breeding them to a male JD would never work. There is no evidence for this, to my knowledge. In fact, Cole has two pairs in this configuration (male JD, female EBJD) and both pairs have produced fry. Unfortunately, as they are inexperienced, the parents have eaten the fry each time, but it seems only a mater of time before they improve their parenting skills and Cole has healthy BGJD juveniles in his tanks. We on the EBJD Forum are waiting with baited breath!

The final point worth discussing at this stage is the theory that an EBJD x EBJD cross will not work. This is certainly well stated in the T.F.H. article copied above. In my opinion, we should not be so quick to dismiss the possibility that this may not entirely be true. From EBJD Forum members who have achieved such crosses, we know that they do result in fry and that in one case these fry lived for 10 days before they were eaten. I have read no accounts stating that the fry died off before they were eaten, so the jury is out until either these EBJD pairs learn to raise their brood, or someone removes the fry from the parents prior to free-swimming to see if they can be raised to in isolation. Given that EBJDs are susceptible to a digestive disorder that is similar to Hexamita infection, it is not unlikely that the fry from an EBJD x EBJD cross are simply much more fragile than we realize, so that it is the water parameters and not a lethal genetic condition that results in their death. I am theorizing now, of course, but I believe it is important that more effort is made to try and raise such spawns, so that we can determine whether the problem is lethal genetics or our own misinterpretation. I am hoping that my own EBJD pair will allow me to make some progress in this area.

Now let us consider the evidence in support of the hypothesis that the EBJD is a natural color-morph, starting with the various tests that have been performed on EBJD DNA. So far, Dr. Prosanta Chakrabarty has carried out two types of DNA test comparing EBJDs to JDs. One was a comparison of mitochondrial DNA (see results above); the second was a comparison of nuclear DNA. In addition, Cole arranged for Dr. David Price to carry out a further nuclear DNA test (results above). Here I will discuss the results of the latter test, as Cole has already considered the results of the mitochondrial DNA test in his section, and neither of us have had access to the results of Dr. Chakrabarty’s nuclear DNA test. Put simply, the results of the test carried out for us by Dr. Price show (in his own words) that “the [EBJD] has only the Jack Dempsey version of the [nuclear] S7 ribosomal protein gene”. While this clearly supports the hypothesis that the EBJD is a natural color-morph of Rocio octofasciata, it only does so insofar as the 500 base pair sequences match. We have no information about the rest of the genome. Dr. Price goes on to point out that “this is only one gene out of some 15 to 30 thousand, but it does mean that the [EBJD] is not a complete polyploid hybrid i.e. it does not have a complete gene compliment, including the S7, from a second species”. This suggests that the EBJD may be diploid (which is true of JDs), having just two sets of chromosomes. However, we cannot rule out the possibility that EBJDs may carry an extra copy (or extra copies) of one or more chromosomes (referred to as polysomy), which may have come from another species. If EBJDs are diploid, this may prove to be the biggest thorn in the side of those who were hoping for and easy route to demonstrating scientifically that the EBJD is not a hybrid.

Where hybridization results in offspring that inherit multiple sets of chromosomes from each parent (i.e. offspring that are polyploid), it is much easier to determine that they are hybrids. Firstly, comparing the number of sets of chromosomes in the polyploid hybrid to the number of sets in the wild-type fish (if diploid) will reveal obvious differences; and secondly, polyploid hybrids are generally unlikely to be able to successfully breed with diploid parent species. This is because large differences in chromosome number tend to result in poorly fertile female hybrids and sterile males (not the case with EBJDs, but possibly very relevant to what is seen in ‘Parrot’ cichlids). What this means for us is that the only real way to show that the EBJD is not a hybrid is to either show that all of the genetic material from an EBJD comes from JDs, or to show that the gene for blue colouration and its flanking sequence only comes from JDs. To the uninitiated this might sound like a relatively straightforward process. It is not. To map the entire EBJD and JD genomes would be a mammoth process involving an inordinate amount of time and money. Likewise, the chances of finding the exact location of the blue gene in the EBJD genome are incredibly small. To put this in perspective: let’s say that the average gene is 2,000 base pairs long, and there are say 20,000 genes in the whole genome. That gives us 40,000,000 base pairs (not including non-coding DNA, which is present in most species). This means that the ~500 base pair sequence considered in the test carried out by Dr. Price is 500/40,000,000, or 0.00125%, of the total DNA in a single cell. To put it bluntly, finding the gene for blue coloration could take forever.

In an ideal world, if EBJDs are hybrids, then showing this to be the case would be a relatively simple matter of comparing a few more sequences of nuclear DNA until we hit a sequence that doesn’t match JD DNA. Surely if a big chunk of the EBJD genome comes from another parent species then pretty soon you’d hit on a mismatching section, right? Wrong. Unfortunately for us, the methods used to breed EBJDs mean that things are not so straight forward. As Dave, a moderator of www.cichlid-forum.com (who also happens to be a molecular biologist!), explains: “[because the production of EBJDs relies explicitly on backcrossing EBJDs to JDs]…over time, as the ‘hybrid’ [is] backcrossed to JDs, the amount of non-JD DNA would be diluted out, but would likely never be completely removed. The backcrossed fish would not retain a complete set of genes from both original parents through these successive rounds of backcrossing. So, you would retain a small amount of this non-JD DNA that you may never be able to remove, especially if this DNA was required for the EBJD phenotype.” So by now, over 90% of the EBJD genome might be JD in origin anyway, even if EBJDs are hybrids. Personally, I can see that there will have been a dilution effect, but why this would only preserve the gene for blue coloration, and not a host of other additional phenotypic genes from the non-JD parent (if there was one) is beyond me. But who’s to say this isn’t the case? Maybe the morphological differences (i.e. differences relating to body shape) between EBJDs and JDs are the result of other non-JD genes that are inherited alongside the gene for blue coloration.

There has been much discussion over the appearance, behavior and hardiness of EBJDs in relation to that of JDs in the aquarium hobby. Many have noted that the facial profile, body shape and pattern of underlying black markings are different between EBJDs and JDs. A counter-argument to this is that EBJDs have undergone selective breeding to some extent and that they are all descended from the original EBJDs discovered by Hector Luzardo. As such it is likely that current EBJDs will have similar physical traits inherited from their EBJD ancestors. Alternatively, it is perfectly possible for a single gene to have multiple effects on phenotype, so it may be that carrying the gene for blue coloration also results in a particular shape and irregular black marking on the body. The shape of the fins is without doubt the result of selective breeding, a fact confirmed to me by Jeff Rapps, who initially imported selectively bred long-finned EBJDs for South America before switching to a shorter-finned strain, which proved to be much hardier after shipping.

In terms of behavior, there is a suspicion that EBJDs are less aggressive than JDs. I would argue that this is largely dependent on the fish in question. As I write, I can see one of my males is busily displaying aggressively to fish on either side of his divided section of the tank. My other male has been harassing my female EBJD all day (his main joy in life) and has been responsible for the demise of all my adult zebra danios and one or two tiger barbs too, despite his 5” total length. I see nothing of the less aggressive fish people talk about. Forum members have also documented violence in their fish, to the extent that there have reports of EBJDs killing siblings and seriously damaging would-be mates. Perhaps the aggression appears later in the development of EBJDs than in JDs. I know my local fish store won’t stock a whole tank with young JDs because they end up trying to kill one anther. They have however kept a whole tank of some thirty 2” EBJDs with no problems whatsoever. There could be something to this theory, but for my part I am at least mildly sceptical.

Is there anything to be learnt from the fact that the blue gene is inherited in a Mendelian fashion? From the EBJD breeding experiences of Randy Sorenson (Ormed) we know that the percentage of EBJD fry in both BGJD x BGJD and EBJD x BGJD spawns meets the expectations of simple Mendelian inheritance (25% and 50% respectively – Randy counted the fry!). Doesn’t this prove that we are not dealing with a hybrid? It certainly adds weight to the fact that we are dealing with a recessive allele for coloration. Whether or not this gene is linked to other genes that result in a susceptibility to certain health issues (or changes in morphology) is unclear. However, as long as the EBJD or BGJD has the same number of chromosomes as its BGJD mate, the fact that both parent fish have a copy of the same gene for blue phenotype (whether from a JD or other species source) means that the offspring would still be able to inherit the gene following a Mendelian pattern. Foiled again!

So, what’s the next step? Short of trying to persuade someone (a university professor maybe?) to take on the huge task of either mapping the entire EBJD and JD genomes, or going fishing (pardon the pun!) for that elusive ‘blue’ gene, the most obvious step is to do a karyotype analysis to compare the number of chromosomes between EBJDs and JDs. Such an analysis would at this stage provide the most insight for the least expense. If you happen to be an expert in karyotyping (or happen to know someone who is) then do get in touch! For my part I would expect that this test would reveal that EBJDs and JDs share the same haploid set of 24 chromosomes. Although this would increase the likelihood that the ‘blue’ gene is a naturally occurring mutation, it would be of little use in disproving the hybrid theory. Sadly this is a case of guilty until proven innocent.

But does it really matter whether or not EBJDs are hybrids? The major complaint against hybrids (apart from that of people who take issue with Man playing God) is that, as a result of being labeled wrongly, they can find their way into pet stores as \'pure\' species. This ultimately has a negative effect on the quality and purity of aquarium stocks, and is particularly serious when the hybrid in question closely resembles a well established species. One example is the man-made Flowerhorn cichlid, some specimens of which are readily mistaken for Amphilophus trimaculatus. With this in mind, people who see the EBJD as a hybrid have expressed concern that the BGJDs produced as part of the EBJD breeding process might be sold as ‘pure’ JDs as they are identical in appearance. However, given their pivotal role in breeding EBJDs, BGJDs currently have a monetary value several times that of JDs (there have been offers in excess of $250 for female BGJDs). This is because it takes at least two years to produce your own (not including the time it takes to achieve an EBJD x JD pair in the first place). It is therefore incredibly unlikely that anyone would willingly sell BGJDs to a shop for the same price as JDs. On the EBJD Forum, we\'ve seen thread after thread outlining how protective people are, or are planning to be, of their BGJDs. And we know for a fact that the commercial breeders around the world all cull their BGJDs to prevent anyone else from breeding EBJDs quickly. The idea that you\'d sell BGJDs as JDs is a bizarre concept to say the least. It would be akin to selling top quality discus for the same price as feeder guppies.

Basically, if people are buying BGJDs, they are most likely buying them from a breeder with the aim of breeding EBJDs themselves (otherwise they may as well buy some nice JDs at their local fish store). What this means, in effect, is that JDs should never get to breed with BGJDs (at least, not without the breeder knowing all about it - though why anyone would pay for a BGJD to breed it with a JD is beyond me: 50% normal fry and 50% BGJD fry, all completely identical in appearance – a nightmare scenario!). As a result, the aquarium strain of JD is very likely to stay free of EBJD genes regardless of whether or not they are hybrid or natural in origin. So, in practical terms, it matters very little if EBJDs and BGJDs are hybrid fish. Essentially, we are already treating JDs as one aquarium fish and EBJDs/BGJDs as another. Providing breeders of the EBJD continue to guard their BGJDs as carefully as they do now, there should be no problem. If, dear reader, you are fortunate enough to possess surplus BGJDs that you can’t bring yourself to cull, allow me to make a small request: when you sell them to the fish store, please make sure: a) that the store labels them as Blue Gene Jack Dempseys; and B) that the label also states that they will breed to produce ~25% EBJD offspring. Then sit back and watch as the store owner’s eyes change into dollar signs!

In the end, the only reason to get to the bottom of whether EBJDs are hybrids or not is simply that we (as EBJD owners, scientists and cichlidophiles) want to know the truth. Those of us who believe that they are a color-morph want to silence the hybrid theorists, so that we can enjoy our fish in peace. We find ourselves tarnished with the same brush as the ‘Parrot’ cichlid fanatics, people rushing at us from all sides with pitch forks and burning torches to demand we abandon this beautiful fish for all time (okay, maybe a slight exaggeration). As for the pitch fork carriers, they too are keen to know the truth, so they can be content in knowing they were right all along. However, there is something wrong with this picture (and I don’t just mean the pitch forks!). Surely if the EBJD was a man-made hybrid someone would have held up their hand by now and admitted that they were hybrids? Just look at ‘Parrot cichlids’ and Flowerhorns. No-one is trying to pretend that they aren’t hybrids and they still sell like hot cakes all over the world. Hybrid fish are big business. In fact at this year’s Aquarama in Singapore, the three fish that dominated the scene were the Asian arrowana, the ‘Parrot cichlid’ and the Flowerhorn. If anything, the suspect origins of hybrid fish has only served to raise their profile in the public eye and may inadvertently have increased their sales; after all there’s no such thing as bad advertising. What reason then would Hector Luzardo have for claiming that the EBJD was a natural mutation if it was in fact a hybrid? According to Jeff Rapps (who knew Luzardo in person), Hector Luzardo “had nothing to gain by publicly fabricating the origin of the fish…He [was] an honest man with strong family values…As he told me years ago, his only merit is the fact that he recognized the difference in some fry produced by a pair of normal Dempseys [which must in fact have been BGJDs] and raised them up.”

With the exception of the late Hector Luzardo, I doubt anyone knows the true origins of the EBJD and I’m not convinced that anyone ever will. Whilst the genetic evidence collected so far supports the hypothesis that the EBJD is a color-morph of the Jack Dempsey, it does not confirm it. There is no quantitative evidence to suggest that the EBJD has hybrid origins. For now, we must wait for the results of Dr. Chakrabarty’s latest experiments and hope that they will tip the scales one way or the other.

_______________________________________________________________________________

You have been reading a long time, but there are just a few other things I want to add:

First of all, many myths have been had about these fish. A lot of them have since proven to be just that, myths. Females were taken to be infertile. I have two ten gallon tanks at this very moment with BGs produced from a EBJD female. One tank has 73, 1\" BGs, and the other has 1000+ 1/2 inch BG fry. One batch is two months old and the other just 30 days. Recently, someone joined the bluejax forum and claimed they have been breeding EBJD x EBJD for years, and while the cross is viable, they produce a much larger percentage of deformities. While there are deformities, this yet again dispells more rumors...EBJDs can indeed spawn with other EBJDs...its not a lethal cross. EBJDs don\'t live to adulthood? Most of us know this is hogwash. Female EBJDs are few and far between? Many, many forum members at bluejax have female EBJDs.

The way I feel about this issue, is that nothing needs to be proven to the hybrid theorists. If they believe with their heart its a hybrid, they need to come up with some type of physical evidence to put up for discussion. I honestly, after all the effort I put into research, fall right in the middle, knowing that conclussive evidence will most likely never be had. But, I do believe in my heart that its most likely a color morph condition. Its simple, when we run out of real solid evidence to support either side, my opinion will reflect that of those who have had the most experience in the area. Some of you have a lot of light to shed on this subject, Rivermud is one that seemingly has a lot of education and important information to throw into the discussion. But, when two molecular biologists working sepreately on the case have held the DNA evidence in their hands, studied the facts of the case carefully, and concluded with the same results, I am more likely to sway my opinions with theirs, rather than other molecular biologists and scientists and students who have not.

In the end, when everyone finds that the truth cannot be had, we will have only our opinions. And as Martin has fairly put it, even if it is a hybrid fish, why is it such a big deal to people? We have many instances of hybrids in the cichlid community that are accepted, and in many other feilds of science their are hybrids that are preffered. As long as they are clearly labeled, and are not misleading, people should not fear a hybrid in the industry. You can clearly see when looking at an EBJD that it is not your average JD. So where is the concern?

Really there should not be concern, and really we should not have an argument between hybrid theorists and color morph theorists without real conclussive evidence at hand. People who own them, I feel are the ones most interested in knowing the truth. They spent a lot of money on their fish, they are extremely beautiful, and people just feel they are entitled to know what kind of fish they have. This is why there was a qwest for answers. The qwest was to supply the owners of EBJDs with the truth, not to supply the hybrid theorists with bullets for debate.

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах

А чего, на языке суахили не было информации? Было бы ещё эротичнее.

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах
:):):):) не обижаюсь а смеюсь! .....есть на испанском - он очень эротичен, по мне!;)

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах
Оригинальное сообщение от dagus

А чего, на языке суахили не было информации? Было бы ещё эротичнее.

А ваш малек сей час в каком возрасте? От пары БД появился? Были проблемы с поднятием малька?

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах

Скажите что может быть с моими блюшками: Было изначально 5шт. Через две недели один стал темнеть и перестал кушать. Потом резко умер без всяких признаков болезни! Сей час один тоже почернел и перестал кушать, грустит.

Остальная рыба в норме.

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах
Оригинальное сообщение от Granata

А ваш малек сей час в каком возрасте?

Старшим малькам два года.

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах
Оригинальное сообщение от Granata

Скажите что может быть с моими блюшками: Было изначально 5шт. Через две недели один стал темнеть и перестал кушать. Потом резко умер без всяких признаков болезни! Сей час один тоже почернел и перестал кушать, грустит.

Остальная рыба в норме.

Ну, какие-то признаки Вы всё же описали. Готов поспорить, что почернение сопровождалось учащённым дыханием. Склонны они к гексаминтозу при малейшем ухудшении условий содержания. Если кормите \"от пуза\", воду надо менять очень часто, и ещё чаще - мыть губки, хотя при этом прочие рыбы зачастую не проявляют никакого беспокойства. Светлая, яркая окраска - свидетельство \"органического благополучия в аквариуме\".

750x500http://s47.radikal.ru/i117/0906/5d/de5d8205dbb4.jpg

[Изменено 9-9-09 ... Grange]

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах

Так другие трое светлые и шустрые!!! В аквасе каждую неделю воду подмениваю где то 1/3. А морда хороша!!!

У меня внешник с эхеймовским пористым субстратом и внутренний фильтр с губкой. С водой все нормально вроде!:(

Про гекс я знаю, но я ну никаких признаков не вижу!!! Все растут как на дрожжях а потом бац...и....

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах

Две недели назад видел малька на нашей птичке.

Поделиться сообщением


Ссылка на сообщение
Поделиться на других сайтах

Создайте аккаунт или войдите в него для комментирования

Вы должны быть пользователем, чтобы оставить комментарий

Создать аккаунт

Зарегистрируйтесь для получения аккаунта. Это просто!

Зарегистрировать аккаунт

Войти

Уже зарегистрированы? Войдите здесь.

Войти сейчас

  • Сейчас на странице   0 пользователей

    Нет пользователей, просматривающих эту страницу.

×